The detailed information of tRNA gene sequence


Sequence ID>W1910765811
Genome IDMNVX01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 47757
End posion on genome 47684
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
gaatgattaT
tRNA gene sequence
GGCTATATAGTTCAGCGGTAGAACGCCTGTCTCATAAGCAGGAGGCTCCGAGTTCGACTC
TCGGTATAGCCATtt
Downstream region at tRNA end position
ataatccgtt
Secondary structure (Cloverleaf model)
>W1910765811	Met	CAT
                   T      ATtt ataatccgtt
                     G - C
                     G - C
                     C - G
                     T - A
                     A - T
                     T - A
                     A - T          T C
                    T     G G C T C     A
        G A        A      | | | | |     G
      C     C T T G       C C G A G     C
      G     | | | |                 T T
      G     G A A C
        T A        G     AGGCT
                    C - G
                    C - G
                    T - A
                    G - C
                    T + G
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK