The detailed information of tRNA gene sequence


Sequence ID>W1910765812
Genome IDMNVX01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 47249
End posion on genome 47177
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
cgagagatta
tRNA gene sequence
GGGCCCATCGTATAACGGTTTATTACATTCGGCTGGCAGTCGAGAAATTCGGGTTCAATT
CCCGATGGGTCCAtaa
Downstream region at tRNA end position
taaaaacatt
Secondary structure (Cloverleaf model)
>W1910765812	Ala	GGC
                   a      Ataa taaaaacatt
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     A - T          T T
                    T     A G C C C     A
      C A A        C      | | | | |     A
    G       T A T G       T C G G G     C
    G         | | |                 T T
    T       T T A C
      T T A        A     AAAT
                    T + G
                    T - A
                    C - G
                    G - C
                    G + T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK