The detailed information of tRNA gene sequence


Sequence ID>W1910765813
Genome IDMNVX01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 37192
End posion on genome 37109
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
atttatataa
tRNA gene sequence
GCGAGGGTAGCGAAGTGGTCAAACGCGCGAGACTCAAAATCTCGTCTCTTAGTGAGTTCA
CAGGTTCGAATCCTGTCTCTCGCAtag
Downstream region at tRNA end position
atataactaa
Secondary structure (Cloverleaf model)
>W1910765813	Leu	CAA
                   a      Atag atataactaa
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G + T
                     G - C          T A
                    T     T G T C C     A
      T G A        A      | | | | |     G
    G       A G C G       A C A G G     C
    G         | | |                 T T
    T       A C G C
      C A A        G     TCTCTTAGTGAGTTC
                    C - G
                    G - C
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK