The detailed information of tRNA gene sequence


Sequence ID>W1910765814
Genome IDMNVX01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 27073
End posion on genome 27002
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
gtgttcttat
tRNA gene sequence
GCCTCCATAGCTCAATGGTAGAGCGGCAGTTTTGTAAACTGTAGGTTGAGGGTTCAATCC
CCTCTGGAGGCTttt
Downstream region at tRNA end position
aaagttctga
Secondary structure (Cloverleaf model)
>W1910765814	Thr	TGT
                   t      Tttt aaagttctga
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     C - G
                     A - T          C T
                    T     C T C C C     A
        A A        A      | | | | |     A
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        G     AGGTT
                    G + T
                    C - G
                    A - T
                    G - C
                    T - A
                  T       A
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK