The detailed information of tRNA gene sequence


Sequence ID>W1910765816
Genome IDMNVY01000002
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 41910
End posion on genome 41995
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
aaaatgtcaT
tRNA gene sequence
GCCTGCGTGGCCCAGTGGTTACGGCGCGGGATTGCTAATCCCGTTTCCCTTGTGGATTCC
CAGGTTCGAATCCTGGCGCAGGCGTat
Downstream region at tRNA end position
tttttacgga
Secondary structure (Cloverleaf model)
>W1910765816	Ser	GCT
                   T      GTat tttttacgga
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C
                     C - G
                     G - C          T A
                    T     G G T C C     A
      T G A        G      | | | | |     G
    G       C C C G       C C A G G     C
    G         | | |                 T T
    T       C G G C
      T A          G     TTTCCCTTGTGGATTC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK