The detailed information of tRNA gene sequence


Sequence ID>W1910765818
Genome IDMNVY01000003
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 3833
End posion on genome 3906
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
atttaatgtc
tRNA gene sequence
GGAACTGTAGTTCAATGGCTTCAGAATTTTCGGCTCCAGACCGAACGATGAGGGTTCGAT
TCCCTCCAGTTCCAtat
Downstream region at tRNA end position
attgttatgc
Secondary structure (Cloverleaf model)
>W1910765818	Trp	CCA
                   c      Atat attgttatgc
                     G - C
                     G - C
                     A - T
                     A - T
                     C - G
                     T - A
                     G - C          T T
                    T     C T C C C     A
    G T A A        A      | | | | |     G
  G         C T T G       G A G G G     C
  C         | | | +                 T T
  T         G A A T
    T C A          T     CGAT
                    T - A
                    T - A
                    C - G
                    G - C
                    G - C
                  C       A
                  T       G
                    C C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK