The detailed information of tRNA gene sequence


Sequence ID>W1910765820
Genome IDMNVY01000005
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 20011
End posion on genome 20081
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
atttgttaga
tRNA gene sequence
GGCCCCATAGTCTAGTGGTAAAATGGCTCGTTTACACCGAGCAGTCCGCAGTTCGATTCT
GCGTGGGGCCAtta
Downstream region at tRNA end position
tgagtgtcga
Secondary structure (Cloverleaf model)
>W1910765820	Val	TAC
                   a      Atta tgagtgtcga
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T T
                    T     G C G T C     A
        G A        A      | | | | |     G
      T     T C T G       C G C A G     C
      G     |   | +                 T T
      G     A A A T
        T A        G     AGTC
                    G - C
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK