The detailed information of tRNA gene sequence


Sequence ID>W1910765822
Genome IDMNVY01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 17234
End posion on genome 17306
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tctttttaat
tRNA gene sequence
GCGCCGGTAGTCTATCGGTTAGGATGCGAGCTTCCCAAGCTCGTGGGCCGGGTTCGATTC
CCGGTCGGCGCACtt
Downstream region at tRNA end position
ttttaaattc
Secondary structure (Cloverleaf model)
>W1910765822	Gly	CCC
                   t      ACtt ttttaaattc
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     G - C
                     G + T          T T
                    T     G G C C C     A
      C T A        A      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | +                 T T
    T       G G A T
      T A          G     TGGG
                    C - G
                    G - C
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK