The detailed information of tRNA gene sequence


Sequence ID>W1910765823
Genome IDMNVY01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 20204
End posion on genome 20128
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
ttttagctaT
tRNA gene sequence
GATCGCGTAGCTCAGCTAGGTTAGAGCGCCGTGCTGATAACGCGGAGGTCCTGGGTTCGA
ATCCCAGCGCGATCATag
Downstream region at tRNA end position
ctaaaaacag
Secondary structure (Cloverleaf model)
>W1910765823	Ile	GAT
                   T      ATag ctaaaaacag
                     G - C
                     A - T
                     T - A
                     C - G
                     G - C
                     C - G
                     G - C          T A
                    T     G A C C C     A
    T C G A        A      | | | | |     G
  A         C T C G       C T G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          G     AGGTC
                    C - G
                    C - G
                    G - C
                    T + G
                    G - C
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK