The detailed information of tRNA gene sequence


Sequence ID>W1910765824
Genome IDMNVY01000011
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 6903
End posion on genome 6976
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
actaaacatG
tRNA gene sequence
GCGGTTGTAGTTCAATGGCTAGAACGCACGGTTGTGGTCCGTGAGACGAGAGTTCGATTC
TCTCCTTCCGCTTat
Downstream region at tRNA end position
aaaagaaaca
Secondary structure (Cloverleaf model)
>W1910765824	His	GTG
                   G      TTat aaaagaaaca
                     G - C
                     C - G
                     G - C
                     G - C
                     T   T
                     T   T
                     G - C          T T
                    T     C T C T C     A
      T A A        A      | | | | |     G
    G       C T T G       G A G A G     C
    G       | | | |                 T T
    C       G A A C
      T A          G     AGAC
                    C - G
                    A - T
                    C - G
                    G - C
                    G - C
                  T       T
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK