The detailed information of tRNA gene sequence


Sequence ID>W1910765825
Genome IDMNVY01000011
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 15560
End posion on genome 15489
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
attattctgt
tRNA gene sequence
GGGTGCGTAGTTTAATGGTAAAATAGTCGGCTCCAGACCGACAGCTCGGGGTTCGATTCC
CTGCGTACCCACtt
Downstream region at tRNA end position
ttaaaatgaa
Secondary structure (Cloverleaf model)
>W1910765825	Trp	CCA
                   t      ACtt ttaaaatgaa
                     G - C
                     G - C
                     G - C
                     T - A
                     G + T
                     C - G
                     G - C          T T
                    T     G T C C C     A
        A A        A      | + | | |     G
      T     T T T G       C G G G G     C
      G     | | | +                 T T
      G     A A A T
        T A        A     AGCT
                    G - C
                    T - A
                    C - G
                    G - C
                    G - C
                  C       A
                  T       G
                    C C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK