The detailed information of tRNA gene sequence


Sequence ID>W1910765826
Genome IDMNVY01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 22142
End posion on genome 22222
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
cttttaaata
tRNA gene sequence
GCCCGGATTGAGCAATGGTAGCTCGCGTGGCTCGAACCCACGTTTCCTCTGGATATCCAG
GTTCGATTCCTGGTCCGGGCGtaa
Downstream region at tRNA end position
ccccatcatg
Secondary structure (Cloverleaf model)
>W1910765826	Ser	CGA
                   a      Gtaa ccccatcatg
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T T
                    T     G G T C C     A
        A A        T      | | | | |     G
      T     C G A G       C C A G G     C
      G     | | | |                 T T
      G     G C T C
        T A        G     TTTCCTCTGGATAT
                    C - G
                    G - C
                    T - A
                    G - C
                    G - C
                  C       C
                  T       A
                    C G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK