The detailed information of tRNA gene sequence


Sequence ID>W1910765828
Genome IDMNVY01000014
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 66456
End posion on genome 66530
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
ggtaatttaT
tRNA gene sequence
GCGTGGGTAGTATAGTGGTTAGTATGTCGCCCTTCCAAGGCGACGGCCCGGGTTCGAGTC
CCGGCCCGCGCATCg
Downstream region at tRNA end position
ttcatttttt
Secondary structure (Cloverleaf model)
>W1910765828	Gly	TCC
                   T      ATCg ttcatttttt
                     G - C
                     C - G
                     G - C
                     T + G
                     G - C
                     G - C
                     G - C          T G
                    T     G G C C C     A
      T G A        A      | | | | |     G
    G       T A T G       C C G G G     C
    G       + | | +                 T T
    T       G T A T
      T A          G     CGGC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK