The detailed information of tRNA gene sequence


Sequence ID>W1910765829
Genome IDMNVY01000014
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 139614
End posion on genome 139686
Amino Acid Pro
Anticodon TGG
Upstream region at tRNA start position
aaatctgcac
tRNA gene sequence
GGGGATGTGGGCCAGCCTGGTAAGCTTCCGGCTTTGGGAGCCGGCGACCCCGGTTCAAAT
CCGGGCATCCCCAttt
Downstream region at tRNA end position
aacatggtaa
Secondary structure (Cloverleaf model)
>W1910765829	Pro	TGG
                   c      Attt aacatggtaa
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T A
                    T     G G G C C     A
      C G A        G      | | | | |     A
    C       C C G G       C C C G G     C
    T         | | +                 T T
    G       A G C T
      G T A        T     CGAC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  T       A
                  T       G
                    T G G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK