The detailed information of tRNA gene sequence


Sequence ID>W1910765830
Genome IDMNVY01000014
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 127535
End posion on genome 127453
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
ataatatcgT
tRNA gene sequence
GCCGCTGTTGGGCAATGGTCGCCCGCTGGTCTTGAGAACCAGTTTCCTCTGGATGTCCCG
GTTCGACTCCGGGCAGCGGCGTat
Downstream region at tRNA end position
gaaaacatta
Secondary structure (Cloverleaf model)
>W1910765830	Ser	TGA
                   T      GTat gaaaacatta
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     T - A
                     G - C          T C
                    T     G G G C C     A
        A A        T      | | | | |     G
      T     C G G G       C C C G G     C
      G     | | | |                 T T
      G     G C C C
        T C        G     TTTCCTCTGGATGT
                    C - G
                    T - A
                    G - C
                    G - C
                    T - A
                  C       A
                  T       G
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK