The detailed information of tRNA gene sequence


Sequence ID>W1910765831
Genome IDMNVY01000014
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 44744
End posion on genome 44661
Amino Acid Leu
Anticodon AAG
Upstream region at tRNA start position
agtaaatcta
tRNA gene sequence
GCGGGGATGCCGGAGCGGTCAAACGGACTGCGTTAAGGCCGCAGTGGCTTAGTGCCTGCG
AAGGTTCGAATCCTTCTCCCCGCAtga
Downstream region at tRNA end position
aaaaaatgga
Secondary structure (Cloverleaf model)
>W1910765831	Leu	AAG
                   a      Atga aaaaaatgga
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C T T C C     A
      C G A        G      | | | | |     G
    G       G G C C       G A A G G     C
    G         | | |                 T T
    T       A C G G
      C A A        A     TGGCTTAGTGCCTGC
                    C - G
                    T - A
                    G - C
                    C - G
                    G - C
                  T       C
                  T       G
                    A A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK