The detailed information of tRNA gene sequence


Sequence ID>W1910765834
Genome IDMNVY01000018
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 26046
End posion on genome 26126
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
ataatcctag
tRNA gene sequence
GCCGTCGTTGGGTAGTGGTAGCCCGCTTGCTTGGAGAGCAAGTTTCCTTTGGATATCCAG
GTTCGATTCCTGGCGACGGCGtac
Downstream region at tRNA end position
ttccattaca
Secondary structure (Cloverleaf model)
>W1910765834	Ser	GGA
                   g      Gtac ttccattaca
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A
                     C - G
                     G - C          T T
                    T     G G T C C     A
        G A        T      | | | | |     G
      T     T G G G       C C A G G     C
      G     + | | |                 T T
      G     G C C C
        T A        G     TTTCCTTTGGATAT
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  T       A
                  T       G
                    G G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK