The detailed information of tRNA gene sequence


Sequence ID>W1910765835
Genome IDMNVY01000018
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 30837
End posion on genome 30907
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
attgtttaaa
tRNA gene sequence
GGGCTTGTAGTATAGGGGTAGTACGTGCGGCTGGCAGTCGTGAGGTTTGGGTTCGACTCC
CGGCAAGTCCAtaa
Downstream region at tRNA end position
aattattttt
Secondary structure (Cloverleaf model)
>W1910765835	Ala	GGC
                   a      Ataa aattattttt
                     G - C
                     G - C
                     G + T
                     C - G
                     T - A
                     T - A
                     G - C          T C
                    T     G G C C C     A
        G A        A      + + | | |     G
      G     T A T G       T T G G G     C
      G     + | | |                 T T
      G     G T A C
        T A        G     AGGT
                    T + G
                    G + T
                    C - G
                    G - C
                    G + T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK