The detailed information of tRNA gene sequence


Sequence ID>W1910765836
Genome IDMNVY01000018
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 8424
End posion on genome 8353
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
gaccacacaa
tRNA gene sequence
GCCCTGGTAGTTTAGTGGCTAAAACATGGCCCTGTCGCGGCCAAGTCCCGGGTTCGATTC
CCGGTCAGGGCGtcc
Downstream region at tRNA end position
ttgattaagg
Secondary structure (Cloverleaf model)
>W1910765836	Asp	GTC
                   a      Gtcc ttgattaagg
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C
                     G + T          T T
                    T     G G C C C     A
      T G A        A      | | | | |     G
    G       T T T G       C C G G G     C
    G       | | | |                 T T
    C       A A A C
      T A          A     AGTC
                    T - A
                    G - C
                    G - C
                    C - G
                    C - G
                  C       C
                  T       G
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK