The detailed information of tRNA gene sequence


Sequence ID>W1910765838
Genome IDMNVY01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 21276
End posion on genome 21348
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ttctactcga
tRNA gene sequence
GACGCTGTAGTGTAGCGGTTAACACGCGGCTCTCATGAGGCCGAGATCGAGGGTTCAACT
CCCTCCAGCGTCAtat
Downstream region at tRNA end position
ttttctcaaa
Secondary structure (Cloverleaf model)
>W1910765838	Met	CAT
                   a      Atat ttttctcaaa
                     G - C
                     A - T
                     C - G
                     G - C
                     C - G
                     T - A
                     G - C          T C
                    T     C T C C C     A
      C G A        A      | | | | |     A
    G       T G T G       G A G G G     C
    G       | | | |                 T T
    T       A C A C
      T A          G     AGATC
                    C - G
                    G - C
                    G - C
                    C - G
                    T + G
                  C       A
                  T       G
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK