The detailed information of tRNA gene sequence


Sequence ID>W1910765839
Genome IDMNVY01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 34590
End posion on genome 34672
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
aggtttgtaa
tRNA gene sequence
GCGGGGGTACCGAAGTGGTCAAACGGGCCGGGTTTAGGCCCCGGGGCTTAGTGCCTGCCT
AGGTTCGAATCCTAGTCCCCGCAttt
Downstream region at tRNA end position
ctaccctttt
Secondary structure (Cloverleaf model)
>W1910765839	Leu	TAG
                   a      Attt ctaccctttt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G + T          T A
                    T     G A T C C     A
      T G A        A      | | | | |     G
    G       A G C C       C T A G G     C
    G         | | |                 T T
    T       A C G G
      C A A        G     GGCTTAGTGCCTGC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  T       C
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK