The detailed information of tRNA gene sequence


Sequence ID>W1910765840
Genome IDMNVY01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 44479
End posion on genome 44550
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
ataatatcat
tRNA gene sequence
GCCTGCATAGCTCAGGGGTAGAGCATTAGTTTTGTAAACTAAGGGTCGGGGGTTCGACTC
CCTCTGCAGGCTtaa
Downstream region at tRNA end position
gatgcaaaac
Secondary structure (Cloverleaf model)
>W1910765840	Thr	TGT
                   t      Ttaa gatgcaaaac
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C
                     C - G
                     A - T          T C
                    T     C T C C C     A
        G A        A      | + | | |     G
      G     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     GGGTC
                    T - A
                    T - A
                    A - T
                    G - C
                    T - A
                  T       A
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK