The detailed information of tRNA gene sequence


Sequence ID>W1910765841
Genome IDMNVY01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 43289
End posion on genome 43215
Amino Acid Val
Anticodon GAC
Upstream region at tRNA start position
ggtttgttaT
tRNA gene sequence
GGCCCTGTGGTCTAGTGGTTATGACGTTCCCTTGACGTGGGAGAGATCCCCGGTTCGATC
CCGGGCAGGGCCATtt
Downstream region at tRNA end position
tttaataatc
Secondary structure (Cloverleaf model)
>W1910765841	Val	GAC
                   T      ATtt tttaataatc
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     T - A
                     G - C          C T
                    T     G G G C C     A
      T G A        G      | | | | |     G
    G       T C T G       C C C G G     C
    G         | | |                 T T
    T       T G A C
      T A          G     AGATC
                    T + G
                    T - A
                    C - G
                    C - G
                    C - G
                  T       T
                  T       G
                    G A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK