The detailed information of tRNA gene sequence


Sequence ID>W1910765842
Genome IDMNVY01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 26799
End posion on genome 26723
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tttaatctgT
tRNA gene sequence
GGCCCTGTAGCTCAGTCTGGATAGAGCGACTGCCTTCTAAGCAGTAGGTCGCGGGTTCGA
ATCCTGTCGGGGCCGTat
Downstream region at tRNA end position
caaacttgtc
Secondary structure (Cloverleaf model)
>W1910765842	Arg	TCT
                   T      GTat caaacttgtc
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     T + G
                     G - C          T A
                    T     T G T C C     A
    C T G A        A      + | + | |     G
  T         C T C G       G C G G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          G     AGGTC
                    A - T
                    C - G
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK