The detailed information of tRNA gene sequence


Sequence ID>W1910765843
Genome IDMNVY01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_35_32 (MNVY)
Start position on genome 25902
End posion on genome 25829
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
gataaatcat
tRNA gene sequence
GCGCAGGTGGCGAAGTGGTTAACGCGCTCGGCTGCAACCCGGGTATTCCGCCGGTTCGAA
TCCGGCCCTGCGCTtgt
Downstream region at tRNA end position
tggattcgaa
Secondary structure (Cloverleaf model)
>W1910765843	Cys	GCA
                   t      Ttgt tggattcgaa
                     G - C
                     C - G
                     G - C
                     C - G
                     A - T
                     G - C
                     G - C          T A
                    T     C G G C C     A
      T G A        G      | | | | |     G
    G       A G C G       G C C G G     C
    G         | | |                 T T
    T       A C G C
      T A          G     TATTCC
                    C - G
                    T + G
                    C - G
                    G - C
                    G - C
                  C       C
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK