The detailed information of tRNA gene sequence


Sequence ID>W1910765847
Genome IDMNVZ01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 62613
End posion on genome 62684
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ttctaatccc
tRNA gene sequence
GGCTCTGTAGCTTAGAGGTAAAGCGCCTGTCTCATGCGCAGGAGATCGAGGGTTCGATTC
CCTCCAGAGCCAtaa
Downstream region at tRNA end position
ctcttataat
Secondary structure (Cloverleaf model)
>W1910765847	Met	CAT
                   c      Ataa ctcttataat
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     T - A
                     G - C          T T
                    T     C T C C C     A
        G A        A      | | | | |     G
      A     T T C G       G A G G G     C
      G     | | | |                 T T
      G     A A G C
        T A        G     AGATC
                    C - G
                    C - G
                    T - A
                    G - C
                    T + G
                  C       C
                  T       G
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK