The detailed information of tRNA gene sequence


Sequence ID>W1910765848
Genome IDMNVZ01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 86540
End posion on genome 86611
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
ttaatttacc
tRNA gene sequence
GCCTCCATAGCTCAGGGGTAGAGCGATAGTTTTGTAAACTATAGGTCGGGGGTTCAAATC
CCTCTGGAGGCTttc
Downstream region at tRNA end position
tagtatgctg
Secondary structure (Cloverleaf model)
>W1910765848	Thr	TGT
                   c      Tttc tagtatgctg
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     C - G
                     A - T          T A
                    T     C T C C C     A
        G A        A      | + | | |     A
      G     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        G     AGGTC
                    A - T
                    T - A
                    A - T
                    G - C
                    T - A
                  T       A
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK