The detailed information of tRNA gene sequence


Sequence ID>W1910765852
Genome IDMNVZ01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 991
End posion on genome 1061
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
taagattaaa
tRNA gene sequence
GGCCCCGTAGTCTAGTGGCAAAACGACTCGTTTACACCGAGTAGTCAGGAGTTCGATTCT
CTTCGGGGCCAttc
Downstream region at tRNA end position
attctctgta
Secondary structure (Cloverleaf model)
>W1910765852	Val	TAC
                   a      Attc attctctgta
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T T
                    T     T T C T C     A
        G A        A      | + | | |     G
      T     T C T G       A G G A G     C
      G     |   | |                 T T
      G     A A A C
        C A        G     AGTC
                    A - T
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK