The detailed information of tRNA gene sequence


Sequence ID>W1910765853
Genome IDMNVZ01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 897
End posion on genome 825
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
aaattatcaT
tRNA gene sequence
GCGGTATTAGTTTAGTGGTAGAACGTTAGGTTGCCAATCTGGAGGCGGGGGTTCGATTCC
CCCATACCGCATtt
Downstream region at tRNA end position
ttcccgcata
Secondary structure (Cloverleaf model)
>W1910765853	Gly	GCC
                   T      ATtt ttcccgcata
                     G - C
                     C - G
                     G - C
                     G - C
                     T - A
                     A - T
                     T - A          T T
                    T     C C C C C     A
        G A        A      | | | | |     G
      T     T T T G       G G G G G     C
      G     + | | |                 T T
      G     G A A C
        T A        G     AGGC
                    T + G
                    T + G
                    A - T
                    G - C
                    G + T
                  T       A
                  T       A
                    G C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK