The detailed information of tRNA gene sequence


Sequence ID>W1910765855
Genome IDMNVZ01000017
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 11681
End posion on genome 11610
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tcttgacatc
tRNA gene sequence
GGGAATGTAGCTCAGTGGGAGAGCACACGACTGAAGCTCGTGGTGTCGGGGGTTCGATTC
CCTCCATTCCCAttt
Downstream region at tRNA end position
ctgtattaac
Secondary structure (Cloverleaf model)
>W1910765855	Phe	GAA
                   c      Attt ctgtattaac
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T
                     T - A
                     G - C          T T
                    T     C T C C C     A
        G A        A      | + | | |     G
      T     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        G A        A     GTGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    A - T
                  C       C
                  T       G
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK