The detailed information of tRNA gene sequence


Sequence ID>W1910765857
Genome IDMNVZ01000023
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 27501
End posion on genome 27584
Amino Acid Leu
Anticodon AAG
Upstream region at tRNA start position
atcaagtagc
tRNA gene sequence
GCGGGGATGCCGGAGCGGTCAAACGGGCCGCGTTAAGGCCGCGGTGGCTTAGTGCCTGCG
AAGGTTCGAATCCTTCTCCCCGCAtta
Downstream region at tRNA end position
gggtccaaaa
Secondary structure (Cloverleaf model)
>W1910765857	Leu	AAG
                   c      Atta gggtccaaaa
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C T T C C     A
      C G A        G      | | | | |     G
    G       G G C C       G A A G G     C
    G         | | |                 T T
    T       A C G G
      C A A        G     TGGCTTAGTGCCTGC
                    C - G
                    C - G
                    G - C
                    C - G
                    G - C
                  T       C
                  T       G
                    A A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK