The detailed information of tRNA gene sequence


Sequence ID>W1910765859
Genome IDMNVZ01000023
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 21435
End posion on genome 21364
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
agaatattat
tRNA gene sequence
GCGTGGGTGGTCTAACGGTATGATTTCGCCCTTCCAAGGCGACGGCCCGGGTTCGACTCC
CGGCCCGCGCACtt
Downstream region at tRNA end position
cttaatgttt
Secondary structure (Cloverleaf model)
>W1910765859	Gly	TCC
                   t      ACtt cttaatgttt
                     G - C
                     C - G
                     G - C
                     T + G
                     G - C
                     G - C
                     G - C          T C
                    T     G G C C C     A
        A A        G      | | | | |     G
      C     T C T G       C C G G G     C
      G       | | +                 T T
      G     T G A T
        T A        T     CGGC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK