The detailed information of tRNA gene sequence


Sequence ID>W1910765860
Genome IDMNVZ01000025
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 25996
End posion on genome 26070
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
aaacctttaa
tRNA gene sequence
GATCCCGTAGTTCAGCCCGGTTAGAACGCTGCTCTGATAAGGCAGAGGTCCCAAGTTCAA
ATCTTGGCGGGATCAttc
Downstream region at tRNA end position
atattacaaa
Secondary structure (Cloverleaf model)
>W1910765860	Ile	GAT
                   a      Attc atattacaaa
                     G - C
                     A - T
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G T T C     A
    C C G A        A      | | | | |     A
  C         C T T G       C C A A G     C
  G         | | | |                 T T
  G         G A A C
    T T A          G     AGGTC
                    C - G
                    T - A
                    G - C
                    C - G
                    T + G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK