The detailed information of tRNA gene sequence


Sequence ID>W1910765863
Genome IDMNVZ01000028
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 7708
End posion on genome 7782
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
ttcccgttaT
tRNA gene sequence
GCCCTTGTAGTCTAGTGGCCAAGGACGACGCCCTTTCGCGGCGTAAACCCGGGTTCGAAT
CCCGGCAGGGGCATtt
Downstream region at tRNA end position
gtaaaaaagg
Secondary structure (Cloverleaf model)
>W1910765863	Glu	TTC
                   T      ATtt gtaaaaaagg
                     G - C
                     C - G
                     C - G
                     C - G
                     T + G
                     T - A
                     G - C          T A
                    T     G G C C C     A
      T G A        A      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | |                 T T
    C       G G A C
      C A A        G     AAAC
                    A - T
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       G
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK