The detailed information of tRNA gene sequence


Sequence ID>W1910765866
Genome IDMNVZ01000031
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 4342
End posion on genome 4271
Amino Acid Arg
Anticodon GCG
Upstream region at tRNA start position
ttgtttttca
tRNA gene sequence
GTCCCCGTAGTTTAGTGGATAGAACAAAACCTTGCGGAGGTTTAGACCGGAGTTCAATTC
TCCGCGGGGACGttt
Downstream region at tRNA end position
ccctctatta
Secondary structure (Cloverleaf model)
>W1910765866	Arg	GCG
                   a      Gttt ccctctatta
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T T
                    T     G C C T C     A
      T G A        A      | | | | |     A
    G       T T T G       C G G A G     C
    G       + | | |                 T T
    A       G A A C
      T A          A     AGAC
                    A - T
                    A - T
                    A - T
                    C - G
                    C - G
                  T       A
                  T       G
                    G C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK