The detailed information of tRNA gene sequence


Sequence ID>W1910765867
Genome IDMNVZ01000034
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 3673
End posion on genome 3745
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
attaaacatG
tRNA gene sequence
GTGGATGTGGTGTAATGGTAGCACGTCAGTCTGTGGCGCTGAAAGCGAGGGTTCGATTCC
CTCCTTCCACTTat
Downstream region at tRNA end position
atgcttccac
Secondary structure (Cloverleaf model)
>W1910765867	His	GTG
                   G      TTat atgcttccac
                     G - C
                     T - A
                     G - C
                     G - C
                     A - T
                     T   T
                     G - C          T T
                    T     C T C C C     A
        A A        G      | | | | |     G
      T     T G T G       G A G G G     C
      G     + | | |                 T T
      G     G C A C
        T A        G     AAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    T + G
                  C       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK