The detailed information of tRNA gene sequence


Sequence ID>W1910765917
Genome IDMNXG01000003
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 48089
End posion on genome 48162
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
ggttaatgtt
tRNA gene sequence
GCTTCCGTAGCTCAGTTGGTCAGAGCGCCGCACTCGTAATGCGGAGGTCCCGAGTTCAAT
CCTCGGCGGAAGCTtac
Downstream region at tRNA end position
actaatgcac
Secondary structure (Cloverleaf model)
>W1910765917	Thr	CGT
                   t      Ttac actaatgcac
                     G - C
                     C - G
                     T - A
                     T - A
                     C - G
                     C - G
                     G - C          C T
                    T     G G C T C     A
      T G A        A      | | | | |     A
    T       C T C G       C C G A G     C
    G       | | | |                 T T
    G       G A G C
      T C A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    A - T
                  C       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK