The detailed information of tRNA gene sequence


Sequence ID>W1910765922
Genome IDMNXG01000017
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 9575
End posion on genome 9503
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
gtttagataT
tRNA gene sequence
GGGCGCGTAGTTTAATGGTAAAATATCTGGCTCCAGACCAGAAGCCGGGGGTTCGATTCC
CTCCGTGCCCATtt
Downstream region at tRNA end position
acaatctttt
Secondary structure (Cloverleaf model)
>W1910765922	Trp	CCA
                   T      ATtt acaatctttt
                     G - C
                     G - C
                     G - C
                     C - G
                     G + T
                     C - G
                     G - C          T T
                    T     C T C C C     A
        A A        A      | + | | |     G
      T     T T T G       G G G G G     C
      G     | | | +                 T T
      G     A A A T
        T A        A     AGCC
                    T - A
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       G
                    C C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK