The detailed information of tRNA gene sequence


Sequence ID>W1910765924
Genome IDMNXG01000018
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 63501
End posion on genome 63430
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
gtttaatcaa
tRNA gene sequence
GCGCGAGTGGTCTAATGGTTATGATTTCGCCCTTCCAAGGCGATGGTCCGGGTTCGATTC
CCGGCTTGCGCAttt
Downstream region at tRNA end position
aattaatatt
Secondary structure (Cloverleaf model)
>W1910765924	Gly	TCC
                   a      Attt aattaatatt
                     G - C
                     C - G
                     G - C
                     C - G
                     G + T
                     A - T
                     G - C          T T
                    T     G G C C C     A
      T A A        G      | | | | |     G
    G       T C T G       C C G G G     C
    G         | | +                 T T
    T       T G A T
      T A          T     TGGT
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK