The detailed information of tRNA gene sequence


Sequence ID>W1910765925
Genome IDMNXG01000019
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 3047
End posion on genome 3121
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ttctaatttT
tRNA gene sequence
GGCTCTGTAGCTTAGTGGTTAAAGCGCCTGTCTCATACGCAGGAGATCGAGAGTTCAATT
CTCTCCAGAGCCATta
Downstream region at tRNA end position
tggatattaa
Secondary structure (Cloverleaf model)
>W1910765925	Met	CAT
                   T      ATta tggatattaa
                     G - C
                     G - C
                     C - G
                     T - A
                     C - G
                     T - A
                     G - C          T T
                    T     C T C T C     A
      T G A        A      | | | | |     A
    G       T T C G       G A G A G     C
    G       | | | |                 T T
    T       A A G C
      T A          G     AGATC
                    C - G
                    C - G
                    T - A
                    G - C
                    T + G
                  C       C
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK