The detailed information of tRNA gene sequence


Sequence ID>W1910765926
Genome IDMNXG01000019
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 10253
End posion on genome 10177
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
ttttatataT
tRNA gene sequence
GGCCTCGTAGCTCAGCCTGGATAGAGCACTTGCCTTCTAAGCAAGGGGTCGCAGGTTCAA
ATCCTGTCGAGGCCGTtg
Downstream region at tRNA end position
gaagaattta
Secondary structure (Cloverleaf model)
>W1910765926	Arg	TCT
                   T      GTtg gaagaattta
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T A
                    T     T G T C C     A
    C C G A        A      + | | | |     A
  T         C T C G       G C A G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          A     GGGTC
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK