The detailed information of tRNA gene sequence


Sequence ID>W1910765927
Genome IDMNXG01000019
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 9458
End posion on genome 9387
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
ttattttcat
tRNA gene sequence
GCGCGGATAGCCAAGTGGTAAGGCAGAAGCCTGCAGAGCTTCCATGCGGGGGTTCGAATC
CCTCTCCGCGCTtac
Downstream region at tRNA end position
cctatagaat
Secondary structure (Cloverleaf model)
>W1910765927	Cys	GCA
                   t      Ttac cctatagaat
                     G - C
                     C - G
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T          T A
                    T     C T C C C     A
        G A        A      | + | | |     G
      T     A C C G       G G G G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATGC
                    G - C
                    A - T
                    A - T
                    G - C
                    C - G
                  C       A
                  T       G
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK