The detailed information of tRNA gene sequence


Sequence ID>W1910765928
Genome IDMNXG01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 32628
End posion on genome 32698
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
cttattccaa
tRNA gene sequence
GGGCCTGTAGTATAGTGGTAGAACATCAGCTTCGCAAGTTGGAGATCCGAGTTCGATTCT
CGGCAGGTCCAttg
Downstream region at tRNA end position
atgaaaaagt
Secondary structure (Cloverleaf model)
>W1910765928	Ala	CGC
                   a      Attg atgaaaaagt
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T T
                    T     G G C T C     A
        G A        A      | | | | |     G
      T     T A T G       C C G A G     C
      G     +   | |                 T T
      G     G A A C
        T A        A     AGAT
                    T + G
                    C - G
                    A - T
                    G + T
                    C - G
                  T       A
                  T       A
                    C G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK