The detailed information of tRNA gene sequence


Sequence ID>W1910765931
Genome IDMNXG01000021
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 5610
End posion on genome 5684
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
gttttgataT
tRNA gene sequence
GGGTCTATAGTTTAATGGATCAGAATAAGGGACTTCGGATCCCTGGATCGAGGTTCGATT
CCTCGTAGGCCCGTaa
Downstream region at tRNA end position
taatgtttaa
Secondary structure (Cloverleaf model)
>W1910765931	Arg	TCG
                   T      GTaa taatgtttaa
                     G - C
                     G - C
                     G - C
                     T + G
                     C - G
                     T - A
                     A - T          T T
                    T     G C T C C     A
      T A A        A      | | | | |     G
    G       T T T G       C G A G G     C
    G       + | | +                 T T
    A       G A A T
      T C A        A     GGAT
                    A - T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK