The detailed information of tRNA gene sequence


Sequence ID>W1910765932
Genome IDMNXG01000022
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 10096
End posion on genome 10172
Amino Acid Pro
Anticodon TGG
Upstream region at tRNA start position
ttattacaaT
tRNA gene sequence
GGGGATGTAGTATAGCCTGGTTAGTATTCGAGGTTTGGGACTTCGCGACCGCGGTTCAAA
TCCGCGCATCCCCATCt
Downstream region at tRNA end position
cataacagaa
Secondary structure (Cloverleaf model)
>W1910765932	Pro	TGG
                   T      ATCt cataacagaa
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T A
                    T     G C G C C     A
    C C G A        A      | | | | |     A
  T         T A T G       C G C G G     C
  G         + | | +                 T T
  G         G T A T
    T T A          T     CGAC
                    C - G
                    G - C
                    A - T
                    G + T
                    G - C
                  T       A
                  T       G
                    T G G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK