The detailed information of tRNA gene sequence


Sequence ID>W1910765934
Genome IDMNXG01000028
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 31999
End posion on genome 32082
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
cattacctaT
tRNA gene sequence
GCCGATGTTGGGCAGTGGTAGCCCGCGGGGTTGCTAACTCCGTTTCCTCACGGATATGCA
GGTTCGATTCCTGCCATCGGCGTtt
Downstream region at tRNA end position
gataatctgg
Secondary structure (Cloverleaf model)
>W1910765934	Ser	GCT
                   T      GTtt gataatctgg
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     T - A
                     G - C          T T
                    T     C G T C C     A
        G A        T      | | | | |     G
      T     C G G G       G C A G G     C
      G     | | | |                 T T
      G     G C C C
        T A        G     TTTCCTCACGGATAT
                    C - G
                    G - C
                    G - C
                    G + T
                    G - C
                  T       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK