The detailed information of tRNA gene sequence


Sequence ID>W1910765935
Genome IDMNXG01000029
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 6658
End posion on genome 6728
Amino Acid Val
Anticodon GAC
Upstream region at tRNA start position
atattgctaa
tRNA gene sequence
GGCCTTGTAAGCTAGTGGTAAACTGCCTCCTTGACGTGGAGGATTCCGCAGTTCAATTCT
GCGCAAGGCCAtgt
Downstream region at tRNA end position
gatttattta
Secondary structure (Cloverleaf model)
>W1910765935	Val	GAC
                   a      Atgt gatttattta
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     T - A
                     G - C          T T
                    T     G C G T C     A
        G A        A      | | | | |     A
      T     T C G A       C G C A G     C
      G     |   | |                 T T
      G     A A C T
        T A        G     ATTC
                    C - G
                    C - G
                    T - A
                    C - G
                    C - G
                  T       T
                  T       G
                    G A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK