The detailed information of tRNA gene sequence


Sequence ID>W1910765937
Genome IDMNXG01000029
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 5390
End posion on genome 5302
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
aaagttgtat
tRNA gene sequence
GCCTGTATAGCTCAGTTGGTAGAGCACTAGTTTTGTACATAGGACGTCAAAAAAACTAGG
GGTCGGGGGTTCAAATCCCTCTACAGGCTttt
Downstream region at tRNA end position
tttcagaaac
Secondary structure (Cloverleaf model)
>W1910765937	Thr	TGT
                   t      Tttt tttcagaaac
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C
                     T - A
                     A - T          T A
                    T     C T C C C     A
      T G A        A      | + | | |     A
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     ACGTCAAAAAAACTAGGGGTC
                    C - G
                    T + G
                    A   A
                    G + T
                    T - A
                  T       C
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK