The detailed information of tRNA gene sequence


Sequence ID>W1910765938
Genome IDMNXG01000032
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 34546
End posion on genome 34616
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
ttagtttcaa
tRNA gene sequence
GGCCCATTAGTCTAGTGGCAAAACGGCTCGTTTACACCGAGCAGTCCGCAGTTCGATTCT
GCGATGGGCCAttc
Downstream region at tRNA end position
tgaattaatc
Secondary structure (Cloverleaf model)
>W1910765938	Val	TAC
                   a      Attc tgaattaatc
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     T - A          T T
                    T     G C G T C     A
        G A        A      | | | | |     G
      T     T C T G       C G C A G     C
      G     |   | |                 T T
      G     A A A C
        C A        G     AGTC
                    G - C
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK