The detailed information of tRNA gene sequence


Sequence ID>W1910765939
Genome IDMNXG01000034
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_132 (MNXG)
Start position on genome 73978
End posion on genome 74052
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
aatcaatcaT
tRNA gene sequence
GCCCTTGTAGTCTAGTGGCCAAGGACGACGCCCTTTCGCGGCGTAAACCCGGGTTCGAAT
CCCGGCAGGGGCATtc
Downstream region at tRNA end position
tataaaactg
Secondary structure (Cloverleaf model)
>W1910765939	Glu	TTC
                   T      ATtc tataaaactg
                     G - C
                     C - G
                     C - G
                     C - G
                     T + G
                     T - A
                     G - C          T A
                    T     G G C C C     A
      T G A        A      | | | | |     G
    G       T C T G       C C G G G     C
    G       + | | |                 T T
    C       G G A C
      C A A        G     AAAC
                    A - T
                    C - G
                    G - C
                    C - G
                    C - G
                  C       C
                  T       G
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK